Username :
Password :
           
Taxon ID: 42,226 Total records: 39,143

Parus ater

Classification

Kingdom Animalia (COL)
Phylum Chordata (COL)
Class Aves (COL)
Order Passeriformes (COL)
Family Paridae (COL)

Taxonomy

Genus Parus Reference
SubGenus Vernacular Name
Species ater IUCN Threat Status-Year Least Concern, 2012
SubSpecies Nat'l Threat Status-Year Not Evaluated, 2000
Infraspecies Reason for Change
Infraspecies Rank CITES
Taxonomic Group Birds Native Status Native
Scientific Name Author Linnaeus, 1758 Country Distribution Myanmar
Citation Description Brief Summary learn more about this article Coal tits look a lot like great tits that have been washed in very hot water. Not only are they more pale than great tits, they are also much smaller. With their 11 centimeters, coals tits are the smallest tit species in Europe. They live mostly in coniferous forests and build their nests close to the ground in decaying trees. Their long thin beaks are perfect for prying insects out of pine cones or tree bark. In the winter, they sometimes visit well-stocked feeding tables. Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © Copyright Ecomare Source: Ecomare TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article ECOLOGY Habitat Habitat and Ecology learn more about this article Systems Terrestrial Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0) © International Union for Conservation of Nature and Natural Resources Source: IUCN TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article LIFE HISTORY AND BEHAVIOR Life Expectancy Lifespan, longevity, and ageing learn more about this article Maximum longevity: 9.5 years (wild) Creative Commons Attribution 3.0 (CC BY 3.0) © Joao Pedro de Magalhaes Source: AnAge TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article MOLECULAR BIOLOGY AND GENETICS Molecular Biology Barcode data: Periparus ater learn more about this article The following is a representative barcode sequence, the centroid of all available sequences for this species. There are 17 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences. CAACCCACAAAGACATTGGCACACTCTACCTAATTTTCGGCGCATGAGCCGGAATGGTAGGAACCGCCCTAAGCCTCCTCATCCGAGCAGAACTTGGCCAGCCCGGCGCCCTCCTGGGAGACGACCAGATCTACAACGTAGTCGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGAGGATTCGGAAACTGACTAGTCCCTCTAATAATCGGAGCCCCCGACATAGCCTTCCCCCGAATAAACAACATAAGCTTCTGACTCCTACCCCCCTCCTTCCTTCTCCTACTAGCCTCCTCCACAGTCGAAGCAGGCGTAGGAACCGGATGAACAGTATACCCACCTCTAGCCGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTCGCTATCTTCTCCCTACACCTAGCGGGGATCTCATCAATCCTAGGGGCAATTAACTTCATCACAACTGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTACTAATCACCGCAGTCCTTCTCCTTCTATCCCTCCCAGTTCTGGCTGCAGGCATCACCATGCTCCTTACCGACCGCAACCTCAACACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAGTACTCTACCAACACTTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTTATCCTCCCAGGATTTGGAATTATCTCCCACGTA -- end -- Download FASTA File Creative Commons Attribution 3.0 (CC BY 3.0) © Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD) TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article Statistics of barcoding coverage: Periparus ater learn more about this article Barcode of Life Data Systems (BOLDS) Stats Public Records: 17 Specimens with Barcodes: 39 Species With Barcodes: 1 Creative Commons Attribution 3.0 (CC BY 3.0) © Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD) TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article CONSERVATION Conservation Status IUCN Red List Assessment learn more about this article Red List Category LC Least Concern Red List Criteria Version 3.1 Year Assessed 2014 Assessor/s BirdLife International Reviewer/s Butchart, S. Contributor/s Justification This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be fluctuating, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern. History 2013 Least Concern (LC) 2012 Least Concern (LC) Least Concern (LC) Not Recognized (NR) Not Recognized (NR) Not Recognized (NR) Not Recognized (NR) Not Recognized (NR) Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0) © International Union for Conservation of Nature and Natural Resources Source: IUCN TRUSTED Article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article Trends Population learn more about this article Population In Europe, the breeding population is estimated to number 12000000-29000000 breeding pairs, equating to 36000000-87000000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 73500000-348000000 individuals, although further validation of this estimate is needed. Population Trend Stable Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0) © International Union for Conservation of Nature and Natural Resources Source: IUCN TRUSTED Article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article Wikipedia Coal tit learn more about this article The coal tit (Periparus ater) is a passerine bird in the tit family Paridae. It is a widespread and common resident breeder throughout temperate to subtropical Eurasia and northern Africa. The black-crested tit is now usually included in this species. Contents 1 Taxonomy and systematics 1.1 Subspecies 2 Description 3 Behaviour and ecology 4 See also 5 Footnotes 6 References 7 External links Taxonomy and systematics[edit] This species was first described by Linnaeus in his 1758 edition of Systema Naturae. Linnaeus primary reference was his earlier Fauna Svecica, whose cumbersome pre-binomial name Parus capite nigro: vertice albo, dorso cinereo, pectore albo ("black-headed tit with white nape, ash-grey back, white breast") became the much simpler yet no less unequivocal Parus ater. This name – meaning "dusky-black tit" – was simply adopted from older ornithological textbooks, ultimately going back to Conrad Gessners 1555 Historiae animalium. Linnaeus description was essentially the slightly rephrased species name from Fauna Svecica: P[arus] capite nigro, dorso cinereo, occipite pectoreque albo. – "a black-headed tit, with ash-grey back, and white back of the head and breast." He gave no type locality except "Europe", but his original description refers to the population inhabiting Sweden (which is consequently included in the nominate subspecies today).[1] The colorful great tit (Parus major) with its bold wing-stripe. Before binomial nomenclature, naturalists found the folk taxonomy of this species and the coal tit quite confusing. Gessner also notes that the coal tit was known as Kohlmeiß in German – the literal equivalent of its English name, though in its modern orthography Kohlmeise it refers to the great tit (Parus major). That bird was in Gessners day usually called Spiegelmeiß ("multicolored tit"[2]), Brandtmeiß ("burnt tit") or grosse Meiß ("great tit") in German. Kölmeyß was attested for P. major by William Turner, but Turner does not list P. ater at all, while Gessner notes that his hunters always used Kohlmeiß for the present species. However, this has since changed, and the modern German name of P. ater is Tannenmeise ("fir tit"), after a typical habitat. This name is attested (as Tannen-Maise) by Johann Leonhard Frisch in the early 18th century already, who furthermore records that P. ater was also called Kleine Kohl-Maise ("small coal tit") whereas Kohl-Maise referred unequivocally to P. major. Frisch collected his data in the Berlin region, where the German dialect was quite different from that spoken by Gessners Alemannic sources 200 years earlier, and heavily influenced by Middle Low German – the language of the northern German sources of Turner. Regarding that, Tanne is derived from the Old Saxon danna, and thus had spread through the German dialect continuum from north to south. [3] Most authorities still treat the coal tit in the subgenus Periparus, but the American Ornithologists Union considers Periparus a distinct genus. This is supported by mtDNA cytochrome b sequence analysis; Periparus seems to be closer to the Poecile tits and chickadees than to the great tit and its relatives. Thus, it belongs to the more advanced Paridae, in which the bright plumage of the more basal lineages is dulled down apomorphically.[4] Illustration of Parus ater cypriotes by John Gerrard Keulemans In addition, the same data suggest that this species is paraphyletic in regard to the closely related and parapatric spot-winged tit (P. melanolophus) from South Asia, which looks like a slightly crested, darker version of P. ater. Consequently, the spot-winged tit might have to be included in P. ater, or some coal tits could be considered a distinct species. As occasional hybridization has been recorded between the two, mtDNA alone (which is inherited only from the mother) is insufficient to determine whether hybrid gene flow or another trivial cause (such as incomplete lineage sorting) obfuscates the actual relationships, or whether taxonomic rearrangement is indeed required. With the range of these titmice encircling the Himalayas, without further study it cannot even be excluded that they constitute a ring species – with gene flow occurring in Nepal but not in Afghanistan –, as has been shown for other passerines in the same region.[4] Subspecies[edit] Adult continental coal tit, P. a. ater (note blue-grey back) A number of coal tit subspecies are distinguished. The differences in coloration are quite pronounced in some of them, while their differences in size are more subtle. Coal tits from Asia follow Bergmanns rule, being larger in colder regions; those from further west, however, do not, as the birds from the uplands around the Mediterranean are larger than those from northern Europe. Across its range, tail length in relation to body length increases along a cline running from southwest to northeast.[5] The British race P. a. britannicus has an olive hue to its brownish-grey back plumage, distinguishing it from the continental European nominate subspecies P. a. ater and P. a. abietum[verification needed] in which the back is bluish grey without a hint of green or brown. The Irish race P. a. hibernicus is distinguished from britannicus by the pale sulphur-yellow cheeks, breast and belly. It also has a paler rump (due to light fringes of the uppertail coverts) and a larger bill than its relatives from Britain and the Continent.[6] The North African race P. a. ledouci has yellow underparts and cheeks, and the Cypriot P. a. cypriotes has a buff tinge to its upperparts, and deep buff underparts. Asian subspecies are generally rather dusky brownish except for the black-and-white head;[5] they include among others P. a. michalowskii of the Caucasus, P. a. phaeonotus of Iran, or the Himalayan coal tit[7] P. a. aemodius of southwestern China. Description[edit] File:Coal tit (Periparus ater).webmPlay media Periparus ater filmed in Tokyo, Japan The coal tit is 10–11.5 cm in length, and has a distinctive large white nape spot on its black head. The head, throat and neck of the adult are glossy blue-black, setting off the off-white sides of the face (tinged grey to yellow depending on subspecies) and the brilliant white nape; the white tips of the wing coverts appear as two wingbars. The underparts are whitish shading through buff to rufous on the flanks. The bill is black, the legs lead-coloured, and irides dark brown. The young birds are duller than the adults, lacking gloss on the black head, and with the white of nape and cheeks tinged with yellow. While searching for food, coal tit flocks keep contact with incessant short dee or see-see calls. The species song – if "song" it can be called – is a strident if-he, if-he, if-he, heard most frequently from January to June, but also in autumn. One variant of this song ends with a sharp ichi. North African birds also have a currr call similar to that of the European crested tit (Lophophanes cristatus) which is not found in Africa. Adult, presumably Irish coal tit, P. a. hibernicus (note yellowish cheeks and breast) Behaviour and ecology[edit] Eggs, Collection Museum Wiesbaden It is typically a bird of temperate humid conifer forest, but apart from that shows little habitat specificity. In Bhutan for example coal tits are fairly common residents above the subtropical zone, at about 3,000-3,800 m ASL, and are found in forests dominated by Bhutan Fir (Abies densa) as well as in those characterized by Himalayan Hemlock (Tsuga dumosa) and rhododendrons.[8] The coal tit is an all-year resident throughout almost all range, making only local movements in response to particularly severe weather; only the Siberian birds have a more regular migration. Very rarely, vagrants may cross longer distances; for example the nominate subspecies of continental Europe was recorded in Ireland once in 1960 and once before that, but apparently not since then. Coal tits will form small flocks in winter with other tits. This species resembles other tits in acrobatic skill and restless activity, though it more frequently pitches on a trunk, and in little hops resembles a treecreeper (Certhia). Its food is similar to that of the others; it is keen on beechmast, picks out the seeds from fir (Abies) and larch (Larix) cones, and joins Carduelis redpolls and siskins in alders (Alnus) and birches (Betula). It will also visit gardens to feed on a variety of foods put out, particularly sunflower seeds. A favourite nesting site is a hole in a rotting tree-stump, often low down, and the nest is deep within the hole; holes in the ground, burrows of mice or rabbits, chinks between the stones in walls, old nests of Pica magpies or other large birds, and squirrel dreys are also occupied. The materials, moss, hair and grass, are closely felted together, and rabbit fur or feathers added for lining. Seven to eleven red-spotted white eggs of the usual tit type are laid, usually in May; this species breeds usually once per year. Being common and widespread, the coal tit is not considered a threatened species by the IUCN.[9] See also[edit] Common treecreeper and Hodgsons treecreeper Greenish warbler Footnotes[edit] ^ Gessner (1555): pp.616, Linnaeus (1746, 1758) ^ Literally "mirror tit" (though its feathers are not iridescent), perhaps rather "wing-stripe tit", as in German ornithology Spiegel means a wing-stripe or -patch. The interpretation referring to its colorful plumage, though somewhat unusual, is the one given by Gesner however: a colorum pulchritudine quibus distinguitur – "for the beauty of its colors, which distinguish it" ^ Turner (1544a,b), Gessner (1555): pp.615-616, Frisch (1720[verification needed]), Linnaeus (1758) ^ a b Gill et al. (2005) ^ a b Snow (1954) ^ BI [2009] ^ Bangs (1932) ^ Inskipp et al. (2000) ^ BLI (2009) References[edit] Wikimedia Commons has media related to Parus ater. Bangs, Outram (1932): Birds of western China obtained by the Kelley-Roosevelts expedition. Field Mus. Nat. Hist. Zool. Ser. 18(11): 343-379. Fulltext at the Internet Archive BirdsIreland.com (BI) [2009]: Irish subspecies – Coal Tit. Retrieved 2009-MAY-17. BirdLife International (BLI) (2008). Parus ater. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 17 May 2009. Frisch, Johann Leonhard (1720[verification needed]): Der II.ten Hauptart I.te Abtheilung von den Maisen – I.te Platte ["First division of the second primary species, the titmice – Plate 1"]. In: Vorstellung der Vögel in Teutschland, und beyläuffig auch einiger fremden, mit ihren natürlichen Farben, etc. (vol. 2): plate 13 [German with Latin and French captions]. F.H.Frisch, Berlin ("Berolinum"). Digitized version Gessner, Conrad (1555): Historiae animalium (vol. 3) [Latin book]. Christoph Froschauer, Zürich ("Tigurium"). Digitized version Gill, Frank B.; Slikas, Beth & Sheldon, Frederick H. (2005): Phylogeny of titmice (Paridae): II. Species relationships based on sequences of the mitochondrial cytochrome-b gene. Auk 122: 121-143. DOI: 10.1642/0004-8038(2005)122[0121:POTPIS]2.0.CO;2 HTML abstract Inskipp, Carol; Inskipp, Tim & Sherub (2000): The ornithological importance of Thrumshingla National Park, Bhutan. Forktail 14: 147-162. PDF fulltext Linnaeus, Carl (1746): 241. Parus capite nigro: vertice albo, dorso cinereo, pectore albo. In: Fauna Svecica Sistens Animalia Sveciæ Regni, etc. (1st ed.): 89 [Latin book]. Conrad & Georg Jacob Wishoff, Leiden ("Lugdunum Batavorum"). Digitized version Linnaeus, Carl (1758): 100.5. Parus ater. In: Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis (10th ed., vol. 1): 190 [Latin book]. Lars Salvius, Stockholm ("Holmius"). Digitized version Snow, D.W. (1954): Trends in geographical variation in Palearctic members of the genus Parus. Evolution 8(1): 19-28. First page image Turner, William (1544a): De paris ["Of the titmice"]. In: Avium praecipuarum, quarum apud Plinium et Aristotelem mentio est, brevis et succincta historia, etc.: 94-95 [Latin book]. Johann Gymnich, Cologne ("Colonia"). Digitized version Turner, William (1544b): [List of German bird names]. In: van Langerack, Gijsbert: Dialogus de avibus, et earum nominibus Graecis, Latinis, et Germanicis, etc.: 95-97 [Latin book]. Johann Gymnich, Cologne ("Colonia"). Digitized version
Source

Images

         

Additional Info

Synonyms


To Manage Synonyms for Parus ater, click this link: Synonyms.
No Synonym records in database.
Common Names


To Manage Common Names for Parus ater, click this link: Common Names.
Localities


To Manage Localities for Parus ater, click this link: Localities.
No Locality records in database.
Species Record Updated By: Carlos Aurelio Callangan