| Citation |
|
Description |
ECOLOGY
Habitat
Habitat and Ecology
learn more about this article
Systems
Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© International Union for Conservation of Nature and Natural Resources Source: IUCN
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
MOLECULAR BIOLOGY AND GENETICS
Molecular Biology
Barcode data: Pomatorhinus erythrogenys
learn more about this article
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTGTACCTAATCTTTGGCGCATGAGCCGGGATAGTTGGTACCGCCCTAAGCCTTCTCATCCGAGCAGAACTTGGCCAACCTGGGGCCCTCCTAGGAGATGATCAAGTATACAATGTAATCGTCACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTCATGCCAATCATAATCGGAGGCTTCGGTAACTGACTCGTCCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCCCGAATAAACAATATAAGCTTCTGACTCCTCCCTCCCTCATTCCTACTACTTCTAGCCTCCTCCACAGTGGAGGCCGGAGCCGGAACCGGTTGAACCGTGTACCCCCCTCTAGCCGGAAACCTAGCACACGCTGGAGCCTCAGTCGACCTGGCCATCTTCTCCCTCCACCTAGCAGGAATCTCATCAATTCTAGGAGCCATCAACTTCATCACAACAGCAATCAACATAAAACCCCCAGCCCTATCACAATACCAAACACCCCTATTCGTATGATCAGTACTCATCACTGCAGTCCTACTCCTACTATCTCTCCCAGTCCTAGCCGCTGGCATCACAATGCTACTAACAGACCGTAACCTAAACACCACCTTCTTCGACCCCGCGGGAGGAGGAGACCCTGTTCTCTACCAACACCTA
-- end --
Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)
© Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD)
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Statistics of barcoding coverage: Pomatorhinus erythrogenys
learn more about this article
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)
© Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD)
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
CONSERVATION
Conservation Status
IUCN Red List Assessment
learn more about this article
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2012
Assessor/s
BirdLife International
Reviewer/s
Butchart, S. & Symes, A.
Contributor/s
Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
History
Least Concern (LC)
Least Concern (LC)
Least Concern (LC)
Lower Risk/least concern (LR/lc)
Lower Risk/least concern (LR/lc)
Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© International Union for Conservation of Nature and Natural Resources
Source: IUCN
TRUSTED
Article rating from 0 people
Default rating: 2.5 of 5
comment on or rate this article
Trends
Population
learn more about this article
Population
The global population size has not been quantified, but the species is described as common (del Hoyo et al. 2007).
Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© International Union for Conservation of Nature and Natural Resources Source: IUCN
TRUSTED
Article rating from 0 people
Default rating: 2.5 of 5
comment on or rate this article
Wikipedia
Rusty-cheeked scimitar babbler
learn more about this article
The rusty-cheeked scimitar babbler (Pomatorhinus erythrogenys) is a species of bird in the Timaliidae family.
It is found in Bangladesh, Bhutan, China, India, Myanmar, Nepal, Pakistan, Taiwan, and Thailand. Its natural habitats are subtropical or tropical moist lowland forests and subtropical or tropical moist montane forests.Sexes alike. Olive brown above; orangish - rufous(rusty) sides of face, head,thighs,flanks; remainder of under body mostly pure white; long, curved scimitar beak. Small bands in forest; a bird of under growth, hopping on jungle floor, turns over leaves or digs with beak; sometimes hops in to leafy branches, but more at ease on ground. FOOD:insects,grubs, seeds. VOICE: noisy; mellow,fluty whistle, two-noted CUE..PE...CUE..pe followed by single note replay by mate; guttural alarm call and a liquid contact note. RANGE:the Himalaya foothills to at least 2200m and possibly to 2600m. HABITAT:forest undergrowth, ravines, bamboo.
subspecies[edit]
Subspecies wise the specie, Pomatorhinus erythrogenys, can be further classified into four sections that is P. e. erythrogenys of north-west Himalayas; P. e. ferrugilatus of central Himalayas from Nepal to Bhutan; P. e. imberbis of Karenni from east Myanmar and P. e. celatus of Shan States of east Myanmar and north-east Thailand.
References[edit]
^ BirdLife International (2012). "Pomatorhinus erythrogenys". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013.
Collar, N. J. & Robson, C. 2007. Family Timaliidae (Babblers) pp. 70 – 291 in; del Hoyo, J., Elliott, A. & Christie, D.A. eds. Handbook of the Birds of the World, Vol. 12. Picathartes to Tits and Chickadees. Lynx Edicions, Barcelona.
|
