| Citation |
|
Description |
Brief Summary
Gelochelidon nilotica
learn more about this article
A medium-sized (14 inches) tern, the Gull-billed Tern in summer is most easily identified by its pale wings, solid black cap, and thick black bill. In winter, this species loses most of its black cap, becoming light gray on the head with black eye-stripes. Male and female Gull-billed Terns are similar to one another in all seasons. The Gull-billed Tern inhabits every continent except Antarctica. In North America, this species breeds along the Atlantic coast of the U.S. south of New York, along the Gulf coast, and in southern California. Populations breeding in the Gulf are non-migratory, while those on the Atlantic and Pacific coasts winter in Florida, on the Gulf coast, and in the tropics as far south as Argentina. Gull-billed Terns primarily breed in dunes, on sandy barrier islands, or in coastal marshes. Similar habitats are utilized during the winter, although this species may also be found further inland in flooded fields at that time of year. Gull-billed Terns primarily eat small aquatic animals, including insects, small fish, and crustaceans. Gull-billed Terns may be observed flying above beaches and near-shore waters while catching prey. This species catches insects in the air, but does not dive into the water to catch fish (unlike many other terns), preferring to skim the surface or catch fish while standing in shallow water. Gull-billed Terns are primarily active during the day.
Threat Status: Least Concern
Gull-billed Tern (Gelochelidon nilotica). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
Molina, K. C., J. F. Parnell and R. M. Erwin. 2009. Gull-billed Tern (Gelochelidon nilotica), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/140
Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
Sterna nilotica. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
eBird Range Map - Gull-billed Tern. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© Smithsonian Institution Supplier: DC Birds TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Distribution
learn more about this article
occurs (regularly, as a native taxon) in multiple nations
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
National Distribution
learn more about this article
United States
Origin: Native
Regularity: Regularly occurring
Currently: Present
Confidence: Confident
Type of Residency: Year-round
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range includes southern California (San Diego Bay, Salton Sea), western coast of Mexico (Sonora, Sinaloa, Baja California, Gulf of California), Atlantic and Gulf coasts of North America from New York (Long Island; scarce north of Maryland) south to Florida and west to southern Texas (also inland); and probably also in Tamaulipas and Veracruz in eastern Mexico, the Bahamas, and Virgin Islands (Anegada, probably Sombrero, formerly Cockroach Bay); in South America (southwestern Ecuador, and from central Brazil south to northern Argentina); and in the Old World from northern Europe, central Russia, southern Mongolia, and eastern China south to northwestern Africa,Asia Minor, Iran, India, Sri Lanka, and southern China; and in Australia (Sprunt 1954, Parnell et al. 1995, AOU 1998).
Nonbreeding range in the Americas includes coastal areas from Nayarit, the Gulf Coast, and southern Florida south through Middle America and the West Indies to Peru and northern Argentina (AOU 1998). In the Old World, the nonbreeding range extends from tropical Africa, Persian Gulf, India, Southeast Asia, eastern China, and the Philippines south to southern Africa, Java, and Borneo; also Australia and Tasmania (AOU 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
PHYSICAL DESCRIPTION
Size
learn more about this article
Length: 36 cm
Weight: 170 grams
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Diagnostic Description
Description
learn more about this article
Length: 35-41 cm. Plumage: back, rump and wing pale grey, rest of upperparts white, with black speckling on nape and heavy black line through eye in non-breeding adult, black cap in breeding adult. Immature whiter than non-breeding adult with some brown on wings; black on head reduced to a facial patch. Bare parts: iris dark brown; thick gull-like bill black; feet and legs black. Habitat: found on coasts, but mostly inland water bodies. Palearctic migrant. <389><391><393>
translation missing: en.license_cc_by_4_0
© WoRMS for SMEBD Source: World Register of Marine Species
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Lacks the long tail streamers of common terns (STERNA HIRUNDO), Forsters terns (S. FORSTERI), and roseate terns (S. DOUGALLII) terns. It is also longer-legged and broader-winged. It can be told from the sandwich tern (S. SANDVICENSIS) by its shorter beak and tail, shallower wingbeat in flight, and more upright posture while sitting.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
ECOLOGY
Habitat
Habitat and Ecology
learn more about this article
Habitat and Ecology
Behaviour Northern breeding populations of this species are migratory, dispersing widely after breeding before travelling southwards to the wintering grounds (del Hoyo et al. 1996). It breeds colonially in monospecific groups of 5-500 pairs (occasionally up to 1,000 pairs) or as solitary pairs amidst colonies of other species (del Hoyo et al. 1996), remaining gregarious outside of the breeding season (Snow and Perrins 1998). Habitat Breeding It breeds in a variety of locations with bare or sparsely vegetated islands, banks, flats, or spits of dry mud and sand (Higgins and Davies 1996) including barrier beaches (shoals), dunes, saltmarshes, saltpans (del Hoyo et al. 1996), freshwater lagoons (del Hoyo et al. 1996, Snow and Perrins 1998), estuaries, deltas (Snow and Perrins 1998), inland lakes, rivers, marshes (Snow and Perrins 1998) and swamps (Higgins and Davies 1996). During this season it may also feed on emerging insects over lakes, agricultural fields, grasslands and even over semi-desert regions (del Hoyo et al. 1996). Non-breeding On passage the species typically forages over saltpans, coastal lagoons, mudflats, marshes and wet fields (del Hoyo et al. 1996), overwintering on estuaries, saltpans (del Hoyo et al. 1996), lagoons (Snow and Perrins 1998) and saltmarshes (Higgins and Davies 1996) or in more inland sites such as large rivers, lakes, rice-fields (Snow and Perrins 1998), sewage ponds, reservoirs, saltpans and irrigation canals (Higgins and Davies 1996). Diet It is an opportunistic feeder and is largely insectivorous (del Hoyo et al. 1996) taking adult and larval terrestrial and aquatic insects (Richards 1990, del Hoyo et al. 1996) (such as Ephemeroptera, Odonata, Lepidoptera and Coleoptera) as well as spiders, earthworms, small reptiles, frogs, small fish (6-9 cm long), aquatic invertebrates and rarely voles and small birds (del Hoyo et al. 1996). Breeding site The nest is a scrape in dried mud, sand or gravel (Richards 1990) on beaches, dry mudflats, dykes, sea-wrack on the tideline or on floating vegetation (del Hoyo et al. 1996). Management information A conservation scheme for the protection of gull and tern breeding colonies in coastal lagoons and deltas (e.g. Po Delta, Italy) involves protection from human disturbance, prevention of erosion of islet complexes, habitat maintenance and the creation of new islets for nest sites (Fasola and Canova 1996). The scheme particularly specifies that bare islets with 30-100 % cover of low vegetation (sward heights less than 20 cm) should be maintained or created as nesting sites (Fasola and Canova 1996).
Systems
Terrestrial
Freshwater
Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© International Union for Conservation of Nature and Natural Resources Source: IUCN
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Depth range based on 6 specimens in 2 taxa.
Water temperature and chemistry ranges based on 5 samples.
Environmental ranges
Depth range (m): 0 - 0
Temperature range (°C): 23.969 - 24.823
Nitrate (umol/L): 0.422 - 1.709
Salinity (PPS): 33.002 - 35.275
Oxygen (ml/l): 4.669 - 4.965
Phosphate (umol/l): 0.118 - 0.342
Silicate (umol/l): 0.946 - 3.398
Graphical representation
Temperature range (°C): 23.969 - 24.823
Nitrate (umol/L): 0.422 - 1.709
Salinity (PPS): 33.002 - 35.275
Oxygen (ml/l): 4.669 - 4.965
Phosphate (umol/l): 0.118 - 0.342
Silicate (umol/l): 0.946 - 3.398
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved
Source: Ocean Biogeographic Information System
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Comments: ALL SEASONS: Coastlines, salt marshes, estuaries, lagoons, plowed fields, and less frequently along rivers, around lakes, and in freshwater marshes (Clapp et al. 1983).
BREEDING: This is a marsh-nesting tern along the coast of New Jersey (Wilson 1840, Stone 1908). Bent (1921) concluded that it had been driven to nest on barrier beaches because of hunting at sites on inner dunes, saltmarshes, and islands. Nesting sites are presently confined to sandy barrier islands, beaches, sandy shores of saline lagoons and marshes, and artificially-produced dredge spoil islands (Clapp et al. 1983). Regional differences in nest sites occur, with the percentage nesting on spoil islands ranging from 28% in New Jersey to 60-80% in North Carolina and 70-84% in Texas (Clapp et al. 1983). Some nest on rooftops in Louisiana (Wiedenfeld and Swan 2000).
Nests are generally located close to landmarks, such as plants or pieces of driftwood, and are usually slight depressions with rims of dried straw and/or shell fragments (Harrison 1975, Sears 1978). Some nests are more elaborate piles of accumulated shell fragments, which may serve to provide protection from drifting sands (Sears 1978). The appearance of the nest lining varies greatly between nests and from day to day in the same nest, depending on the individual, the time available for placing the lining, and weather conditions (Sears 1976, 1978).
NONBREEDING: Gull-billed terns sleep and loaf on dikes, mudflats, and sandspits (Stiles and Skutch 1989).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Depth range based on 6 specimens in 2 taxa.
Water temperature and chemistry ranges based on 5 samples.
Environmental ranges
Depth range (m): 0 - 0
Temperature range (°C): 23.969 - 24.823
Nitrate (umol/L): 0.422 - 1.709
Salinity (PPS): 33.002 - 35.275
Oxygen (ml/l): 4.669 - 4.965
Phosphate (umol/l): 0.118 - 0.342
Silicate (umol/l): 0.946 - 3.398
Graphical representation
Temperature range (°C): 23.969 - 24.823
Nitrate (umol/L): 0.422 - 1.709
Salinity (PPS): 33.002 - 35.275
Oxygen (ml/l): 4.669 - 4.965
Phosphate (umol/l): 0.118 - 0.342
Silicate (umol/l): 0.946 - 3.398
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain
Source: Ocean Biogeographic Information System
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Migration
learn more about this article
Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.
Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).
Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.
North American birds migrate as far south as Peru and the Guianas (Hilty and Brown 1986). Migration along the coast of Costa Rica occurs September-early November (mainly Pacific coast) and April-May (both coasts) (Stiles and Skutch 1989). Arrives in eastern U.S. breeding areas usually in mid-April, adults depart usually in late July and early August (Erwin 1979).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Trophic Strategy
learn more about this article
Comments: Eats mainly various insects, also other invertebrates, and small vertebrates, including eggs and young of other birds; forages mostly over and in fields and marshes, occasionally picks prey from water surface, rarely dives into water. Foraging normally takes place within 10 km of the colony (Sears 1976). Unlike other terns, rarely feeds over open water (Ashmole 1971); instead forages by flying low over marshes, open fields, shrubs, and agricultural fields, with a gull-like flight. Upon locating food, stall briefly, then drop to the ground, vegetation, or substrate to capture prey (Cramp 1985). Their feeding behavior is similar to that of the laughing gull (LARUS ATRICILLA) with which they are frequently observed feeding over agricultural fields (Meanley 1981).
Gull-billed terns sometimes forage over quiet estuaries and ponds, where they pick fish and invertebrates from the surface. Unlike other species of terns, they rarely dive. They sometimes feed with black skimmers on small fish concentrated in drying marsh pools (J. Via, pers. obs.). They rarely feed in conspecific groups because many of their invertebrate prey tend to be dispersed rather than aggregated like the fish schools exploited by other species of terns (Erwin 1978).
Major dietary items include arthropods, locusts, grasshoppers, dragonflies, insects, spiders, and marine life such as fiddler crabs, crustacea, crabs, and sand bugs (Wilson 1840, Bent 1921, Sprunt 1954, Rohwer and Woolfenden 1968, Cramp 1985, Quinn and Wiggins 1990). Vertebrate fauna consumed by the gull-billed tern include fish, frogs, toads, lizards, small mammals (Bent 1921, Dementev et al. 1951, Bannerman 1962), green anoles (ANOLIS CAROLINENSIS) (Rohwer and Woolfenden 1968), and mice (Hobbs 1976).
These birds are occasional opportunistic predators on the downy chicks of other beach-nesting birds including gull-billed (Zubakin 1975) and least terns (Densmore 1990), and possibly piping plovers (CHARADRIUS MELODUS) (R. Cross, pers. comm.).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Population Biology
Number of Occurrences
learn more about this article
Note: For many non-migratory species, occurrences are roughly equivalent to populations.
Estimated Number of Occurrences: 81 to >300
Comments: This species is represented by a large number of breeding occurrences (subpopulations).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Global Abundance
learn more about this article
100,000 - 1,000,000 individuals
Comments: Global population was estimated at 79,000-310,000 in 2002 (Wetlands International). National Audubon Society waterbird conservation website (http://web1.audubon.org/waterbirds) reported the global population at 195,000. The European population is fewer than 22,000 pairs (BirdLife International 2004).
The current U.S. population of the eastern subspecies aranea (which breeds along the Atlantic and Gulf of Mexico coasts of the United States and northeastern Mexico) is unlikely to exceed 3,600 pairs, with over 60% of these birds occurring in Texas (Molina and Erwin 2006). As few as 250 pairs of subspecies vanrossemi nest at only two locations in the United States, both in California (Molina and Erwin 2006). Including populations in western Mexico, the entire vanrossemi population totals 600-800 pairs (Molina and Erwin 2006).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
LIFE HISTORY AND BEHAVIOR
Life Expectancy
Lifespan, longevity, and ageing
learn more about this article
Maximum longevity: 16 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)
© Joao Pedro de Magalhaes Source: AnAge
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Reproduction
learn more about this article
NESTING: Nests in single pairs, small scattered groups, or colonies; typically joins mixed species colonies with common terns, and black skimmers (RYNCHOPS NIGER), least terns (STERNA ANTILLARUM), royal terns (S. MAXIMA), sandwich terns, and/or caspian terns (S. CASPIA). Most of the gull-billed tern colonies studied in Virginia and North Carolina were small (mean = 45 birds) (Erwin 1978), but colony size ranges up to several hundred along the Gulf Coast.
Distances between nests ranges from two to 114 meters, with a mean of 21 meters (Sears, pers. comm., cited by Cramp 1985), although the inter-nest distance may vary as a function of colony size (Moller 1982). Vegetation in nesting areas is sparse, e.g., approximately 15% of the ground was covered in a North Carolina colony (Soots and Parnell 1975).
Clutch size is one to three eggs (Bent 1921, Sears 1978, Moller 1981) and occasionally four (Bent 1921, Forbush 1939, Pemberton 1927, Harrison 1978). Clutch size in one study was found to be significantly greater in larger colonies (Moller 1981). Renesting attempts usually result in smaller clutches (Sears 1978).
Display a variety of behaviors related to courtship or nest defense. Ritualized courtship behavior, for example, include aerial flights, a variety of terrestrial displays, and courtship feeding (Bent 1921, Lind 1963, Sears 1976, 1981). Defecating away from the nest may reduce the risk posed by nest predators (Sears 1978). They also frequently remove eggshells from the nest after hatching (Cullen 1960), but this response is not as strong as it with other tern species, probably because the cryptically-colored young leave the nest several days after hatching (Sears 1978).
The eggs are incubated by both the male and the female for 22-24 days (Harrison 1975), and only one brood is raised per season (Bent 1921, Forbush 1939). The major factors that determine the time at which the young leave the nest are the age of the chicks, the proximity of vegetation, and disturbance (Sears 1978). The young are tended by both parents and fledge at four to five weeks of age (Harrison 1975).
Nesting success appears to be low, with many colonies producing no young at all (Blus and Stafford 1980). The main causes of breeding failure are flooding of low-lying colonies, disturbance by humans, and predation (Clapp et al. 1983).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
MOLECULAR BIOLOGY AND GENETICS
Molecular Biology
Barcode data: Gelochelidon nilotica
learn more about this article
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 9 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GTGACCTTCATCAACCGATGATTATTTTCAACAAACCACAAAGATATTGGCACCTTATACTTAATTTTTGGTGCATGAGCCGGCATAGTAGGTACTGCCCTTAGCCTACTCATTCGTGCAGAACTAGGTCAACCAGGAACCCTCCTAGGAGATGACCAAATCTACAACGTAATCGTCACCGCCCACGCCTTCGTAATAATTTTCTTCATAGTAATGCCCATCATAATCGGGGGCTTCGGAAACTGATTAGTCCCACTTATAATCGGTGCCCCAGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCGTCATTCCTACTTCTCCTAGCCTCCTCCACAGTAGAAGCGGGGGCAGGCACAGGATGAACTGTATACCCTCCTCTAGCTGGTAATCTAGCTCATGCTGGAGCTTCAGTAGATTTAGCAATCTTCTCCCTCCATCTAGCAGGTGTATCATCCATCCTGGGCGCTATCAACTTTATCACTACAGCTATCAACATAAAACCCCCTGCTCTTTCACAATACCAGACCCCTCTATTCGTATGATCCGTACTTATTACTGCTGTCCTATTACTACTCTCGCTCCCAGTACTTGCCGCCGGCATCACTATGCTATTAACAGACCGAAACCTAAACACAACATTCTTTGACCCTGCCGGAGGTGGTGACCCCGTACTATACCAACATCTCTTCTGATTCTTTGGCCACCCAGAAGTATACATCTTAATCTTACCAGGCTTTGGAATTATCTCCCACGTCGTAACATACTACGCGGGCAAAAAAGAACCATTTGGTTACATAGGAATAGTATGAGCCATATTATCCATCGGATTCTTAGGTTTCATTGTATGAGCCCATCATATATTTACAGTTGGAATAGACGTA
-- end --
Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)
© Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD)
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Statistics of barcoding coverage: Gelochelidon nilotica
learn more about this article
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)
© Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD)
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
CONSERVATION
Conservation Status
IUCN Red List Assessment
learn more about this article
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2015
Assessor/s
BirdLife International
Reviewer/s
Butchart, S.
Contributor/s
Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
History
2014
Least Concern (LC)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© International Union for Conservation of Nature and Natural Resources Source: IUCN
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
National NatureServe Conservation Status
learn more about this article
United States
Rounded National Status Rank: N4B,N4N : N4B: Apparently Secure - Breeding, N4N: Apparently Secure - Nonbreeding
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
NatureServe Conservation Status
learn more about this article
Rounded Global Status Rank: G5 - Secure
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Status in Egypt
learn more about this article
Regular passage visitor and winter visitor.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© Bibliotheca Alexandrina Source: Bibliotheca Alexandrina - EOL Ar
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Trends
Population
learn more about this article
Population
The global population of G. nilotica and G. macrotarsa combined is estimated to number c.150,000-420,000 individuals (Wetlands International 2006) but the population of G. nilotica has not been estimated following the taxonomic split.
Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© International Union for Conservation of Nature and Natural Resources Source: IUCN
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Global Short Term Trend: Relatively stable to decline of 30%
Comments: Overall, the current global rate of decline probably is less than 30 percent over 10 years or three generations. Trends are difficult to determine because the species tends to nest in small, scattered, and often ephemeral colonies (Molina and Erwin 2006).
Global Long Term Trend: Unknown
Comments: GLOBAL: No global trends are apparent although local increases and decreases have been noted for different subpopulations (Moller 1975, Cramp 1985).
EUROPE: Declines were noted through the 1900s in northwestern Europe (Evans 1984). A moderate decline occurred in Europe between 1970 and 1990 (BirdLife International 2004). Although the species was broadly stable in southwestern Europe and Russia during 1990-2000, it declined in southeastern Europe and continued to decline overall (BirdLife International 2004).
NORTH AMERICA: Kress et al. (1983) noted a declining U.S. population. Buckley and Buckley (1984) suggested that the eastern population was declining. In Virginia, the population declined 88% between 1975 and 1988 (Byrd and Johnston 1991). Gulf Coast population is concentrated in southern Texas and was estimated at 4,250 in 1982; at that time it may have been increasing (Spendelow and Patton 1988). Populations in the southeastern United States were relatively stable in the 1980s (Clapp and Buckley 1984).
More recent analyses indicate that the breeding range of the species has contracted and shifted slightly from the known historical range in the middle Atlantic states (Molina and Erwin 2006). The Texas population has remained generally stable, but population declines have occurred in Maryland (where probably extirpated), Virginia, North Carolina, Florida, and possibly Georgia (Molina and Erwin 2006). In eastern Mexico, historical information is almost nonexistent, and knowledge of current distribution and abundance is incomplete (Molina and Erwin 2006), so trend is uncertain.
Population changes in the northeastern part of the North American range are probably responses to changes in populations farther south. Expanding populations or breeding ranges in northern states might reflect "overflow" birds from increasing southern populations (Buckley and Buckley 1984). Similarly, decreases in the northern population might reflect reduction in numbers at southern colonies, as well as other factors such as destruction of northern breeding habitats or increased mortality of wintering birds. Distinguishing among these and other possible causes of decline is difficult and probably requires long-term data on breeding and wintering numbers throughout the range. Counts from single colonies or even single regions may be impossible to interpret in isolation.
Nesting range expanded north from Mexico to California beginning in the 1920s, but the Salton Sea population has declined significantly since then. Some range contraction may have occurred in western Mexico (e.g., in Sonora) (Molina and Erwin 2006).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Threats
learn more about this article
Major Threats
The species is threatened by the deterioration and loss of habitat, e.g. through wetland drainage, agricultural intensification, pesticide pollution, fluctuating water levels (del Hoyo et al. 1996), beach erosion and the development or modification of foraging sites (Molina and Erwin 2006). It also suffers from reduced reproductive successes as a result of human disturbance at breeding colonies (del Hoyo et al. 1996, Molina and Erwin 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© International Union for Conservation of Nature and Natural Resources Source: IUCN
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Degree of Threat: Medium
Comments: This species was historically decimated by egg collectors and plume hunters. Via and Duffy (1992) concluded that loss of upland foraging sites and island nesting sites has probably been the greatest threat, although predation and competition with gulls, and human disturbance at colonies have also contributed to declines. Other threats include beach erosion and development.
Main threats to populations in North America include loss of natural nesting islands through beach erosion or perturbations to estuarine functions, development or modification of upland habitats near breeding areas that may be important for foraging, and disturbances to colonies by humans and feral or human-subsidized predators (Molina and Erwin 2006).
HABITAT LOSS: Destruction of marshes and nesting sites has probably been the most important problem in the past for gull-billed terns and other waterbirds (Erwin 1980). The past effects of marsh ditching on nesting and foraging are unknown, as are the historical population levels before market hunting and marsh drainage. Today, however, most northeastern marshes are either publicly owned or subject to laws that, at least in theory, protect them from further damage.
ENVIRONMENTAL CONTAMINATION: At the mouths of major estuaries, terns may be exposed to a wide variety of water-borne contaminants, including crude oil and other petroleum products. Analyses of eggs from South Carolina, however, indicated that levels of hydrocarbons were insufficient to induce eggshell thinning and reproductive failure (Blus and Stafford 1980).
HUMAN DISTURBANCE: Human disturbance may include a wide variety of human activities ranging from walking near nesting colonies to more severe forms of disturbance, such as vehicular traffic and slaughter of waterbirds (Parnell et al. 1988). Disturbance may result in desertion of nesting areas or exposure of eggs and chicks to extreme temperatures, rain, wind, and numerous predators, particularly gulls. Human disturbance has its most disastrous effects following hatching, because chicks may leave the nest prematurely and suffer excessive mortality (Sears 1978). Erwin (1980) compared barrier island nest sites in New Jersey with those in Virginia and found that the New Jersey sites were less frequently used by terns because of human disturbance. While there are no guidelines for the minimum distance at which gull-billed terns will flush, Erwin (1989) has proposed a minimum distance of 200 m for posting colonies of black skimmers and common terns, species with which gull-billed terns often nest. However, because these birds are extremely sensitive to disturbance during the nesting period (Sears 1978), even these distances may be insufficient.
PREDATION/COMPETITION: Both pet and feral dogs may pose a problem. Potential mammalian predators include raccoons, red foxes, and rats (Rattus spp.). Suspected rat predation on the eggs and nests was reported in two studies (Sears 1978, Blus and Stafford 1980). Nocturnal avian predators of common terns that are also likely to prey on gull-billed terns include great horned owls and black-crowned night-herons (Nisbet 1975, Morris and Wiggins 1986). Potential diurnal avian predators in the northeast include, laughing gulls, herring gulls, and great black-backed gulls (Buckley and Buckley 1972). Blus and Stafford (1980) suggested that predation by laughing gulls caused nearly complete nesting failure from 1972-75 in South Carolina. Other avian predators include the fish crow and northern harrier. During a period of population decline in Virginia (1975-90), there was an almost a ten-fold increase in the numbers of herring and great black-backed gulls, species which may usurp nesting sites or prey on gull-billed terns (Williams et al., in press). Nesting common terns have abandoned the barrier islands for a more protected, human-made island in the Chesapeake Bay (Williams et al., in press) and this may have left the remaining gull-billed terns at greater risk from predation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Management
learn more about this article
Preserve Selection and Design Considerations: Moller (1981) suggested that successful colonies need both a safe and acceptable nesting site and suitable nearby foraging areas. May be more vulnerable to human actions than terns that feed at sea because of their dependence on terrestrial foraging sites. For example, if upland foraging areas around a protected wetland are being converted from agricultural use to housing, or if fields are succeeding to second-growth forests, there simply may not be enough foraging area to support a colony, no matter how suitable the colony site itself is. There may also be a fundamental difference in foraging suitability of saltmarshes of the "New England" and the "Coastal Plain" types (Nixon 1982). The former, located from Connecticut to Maine along a subsiding coast, are usually limited in area, so the south shore of Long Island, the northernmost extension of the Coastal Plain marsh, may also mark the northern limit of breeding.
Management Requirements: With the possible exception of the Virginia population, it is unlikely that populations in the Northeast region will be large enough in the near or mid-term future to manage directly at the species-level. Fluctuations in populations in the Northeast are probably heavily influenced by changes in the main population in the Southeast Region.
Protecting colonies of the waterbirds with which gull-billed terns nest may be the most effective management strategy in the Northeast. Protecting wetlands where they feed is also important, although at present not enough is known about the foraging requirements to recommend such management. Would benefit from management techniques such as those used to protect least tern nesting colonies. Protection of nesting colonies by posting, gull control, and creation of artificial nesting islands are management techniques that could assist recovery of populations (Via and Duffy 1992).
Nesting colonies should be posted with 200 meter buffers following the recommendations of Erwin (1989), and the posting should be reinforced by appointment of "tern wardens" to patrol the colonies. Areas where gulls are competing with gull-billed terns for nesting spaces or where gulls pose a potential predation problem should be considered for some form of gull control or removal. Routine predator control should not be undertaken unless a problem is severe because such efforts may themselves generate considerable disturbance for other nesting waterbirds.
Management Research Needs: Virtually all aspects of the life cycle and biology need further research. Particular attention should be paid to foraging requirements and population movements of this species (Via and Duffy 1992). How far do the birds feed from colonies? In what habitats? What foods are taken from such habitats and do they affect nesting success?
Dispersal between colonies also needs to be measured, either through banding or biochemical genetic studies. These data would tell us which colonies are responsible for colonizing the northern states and whether local changes in populations are caused by changes in local reproductive success or immigration.
As a southern species intruding into the Northeast region, the terns may be a sensitive indicator of climate change and global warming (Duffy and Nettleship, in press). Shifts in breeding range or population distribution might also be early warnings of shifts in marsh habitats. Similarly, because of their terrestrial and marsh foraging habits, gull-billed terns may respond to local differences in pesticide levels more closely than do other terns that feed at sea.
Finally, almost nothing is known of the ecology or distribution during migration or on the wintering grounds. Changes in numbers on the breeding grounds may be caused by events thousands of miles away. These basic natural history questions remain to be addressed.
Biological Research Needs: Key research needs include: more frequent and refined population monitoring; better understanding of demographics, metapopulation dynamics, and factors limiting populations; and refinement of our knowledge of subspecies breeding distributions and wintering ranges (Molina and Erwin 2006).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed
Comments: On a global scale, probably there are many adequately protected occurrences.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
WIKIPEDIA
Gull-billed tern
learn more about this article
The gull-billed tern (Gelochelidon nilotica) formerly Sterna nilotica (Bridge et al., 2005), is a seabird of the tern family Sternidae. It is now considered to be in its own genus.
Contents
1 Description
2 Subspecies
3 Range
4 Life history
5 Various views and plumages
6 References
7 External links
Description[edit]
Eggs, Collection Museum Wiesbaden
This is a fairly large and powerful tern, similar in size and general appearance to a Sandwich tern, but the short thick gull-like bill, broad wings, long legs and robust body are distinctive. The summer adult has grey upperparts, white underparts, a black cap, strong black bill and black legs. The call is a characteristic ker-wik. It is 33–42 cm (13–17 in) in length and 76–91 cm (30–36 in) in wingspan.[2][3] Body mass ranges from 150–292 g (5.3–10.3 oz).[4]
In winter, the cap is lost, and there is a dark patch through the eye like a Forsters tern or a Mediterranean gull. Juvenile gull-billed terns have a fainter mask, but otherwise look much like winter adults.
Juvenile Sandwich terns have a short bill, and are frequently mistaken for gull-billed tern where the latter species is uncommon, such as North Sea coasts.
Subspecies[edit]
There are six listed Subspecies of the gull-billed tern:[5]
G. n. nilotica – (Gmelin, 1789): Europe, North Africa though the Middle East & south-central Asia to western China & Thailand
G. n. affinis – (Horsfield, 1821): Japan, south and east China through southeast Asia to the Philippines, Borneo, Sulawesi & Sumatra
G. n. macrotarsa – (Gould, 1837): Australia
G. n. aranea – (Wilson, 1814): eastern & southern USA, Greater Antilles
G. n. vanrossemi – (Bancroft, 1929): southern California to northwestern Mexico
G. n. gronvoldi – (Mathews, 1912): French Guiana to northeastern Argentina
Range[edit]
It breeds in warmer parts of the world in southern Europe, temperate and eastern Asia, both coasts of North America, eastern South America and Australia. This bird has a number of geographical races, differing mainly in size and minor plumage details.
All forms show a post-breeding dispersal, but the northern breeders are most migratory, wintering south to Africa, the Caribbean and northern South America, southern Asia and New Zealand.
The gull-billed tern is one of the species to which the Agreement on the Conservation of African-Eurasian Migratory Waterbirds (AEWA) applies.
Life history[edit]
Non-breeding in Chilika, Odisha, India.
Juvenile/ 1st winter in Chilika, Odisha, India.
This species breeds in colonies on lakes, marshes and coasts. It nests in a ground scrape and lays two to five eggs. While widely distributed in freshwater areas in Eurasia, it is associated almost solely with saltwater, coastal areas in North America.[2]
This is a somewhat atypical tern, in appearance like a Sterna tern, but with feeding habits more like the Chlidonias marsh terns, black tern and white-winged tern. It used to be grouped in the genus Sterna but is now placed on its own in the genus Gelochelidon.
The gull-billed tern does not normally plunge dive for fish like the other white terns, and has a broader diet than most other terns. It largely feeds on insects taken in flight, and also often hunts over wet fields and even in brushy areas, to take amphibians and small mammals, as well as small birds and the chicks and eggs of other terns.[2] It is also an opportunistic feeder, and has been observed to pickup and feed on dead dragonflies from the road.[6]
Various views and plumages[edit]
Gelochelidon nilotica.jpg
in Krishna Wildlife Sanctuary, Andhra Pradesh, India.
van Rossems gull-billed terns at the San Diego National Wildlife Refuge
Gull-billed tern Bangalore, Sngama river
File:Gull-billed Tern96.oggPlay media
References[edit]
^ BirdLife International (2012). "Sterna nilotica". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013.
^ a b c [1] (2011).
^ [2] (2011).
^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
^ "Coursers, noddies, gulls, terns, auks and sandgrouse". International Ornithological Congress. Retrieved 2015-01-11.
^ S. Sivakumar (2004). "Gull-billed Tern Gelochelidon nilotica (Gmelin, 1789) feeding on insect road kills". Newsletter for Ornithologists 1 (1–2): 18–19.
Bridge, E. S.; Jones, A. W. & Baker, A. J. (2005): A phylogenetic framework for the terns (Sternini) inferred from mtDNA sequences: implications for taxonomy and plumage evolution. Molecular Phylogenetics and Evolution 35: 459–469. PDF fulltext
Collinson, M. (2006). Splitting headaches? Recent taxonomic changes affecting the British and Western Palaearctic lists. British Birds 99(6): 306-323.
Harrison, Peter (1988): Seabirds (2nd edition). Christopher Helm, London ISBN 0-7470-1410-8
National Geographic Society (2002): Field Guide to the Birds of North America. National Geographic, Washington DC. ISBN 0-7922-6877-6
Olsen, Klaus Malling & Larsson, Hans (1995): Terns of Europe and North America. Christopher Helm, London. ISBN 0-7136-4056-1
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)
Source: Wikipedia
UNREVIEWED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
NAMES AND TAXONOMY
Taxonomy
learn more about this article
Comments: Formerly (AOU 1983, 1998) included in the genus Sterna but separated on the basis of genetic data that correspond to plumage patterns (Bridge et al. 2005).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© NatureServe Source: NatureServe
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article |
