| Citation |
|
Description |
OVERVIEW
Distribution
Range
learn more about this article
Palearctic; winters to s Africa, s Asia and Australasia.
Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
Partner Web Site: Cornell Laboratory of Ornithology
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
PHYSICAL DESCRIPTION
Diagnostic Description
Description
learn more about this article
Length: 23-25 cm. Plumage: above brownish grey; below white with some streaking on sides of neck and chest; indistinct long whitish superciliary line; barred white tail--bars restricted to tail; white wedge on back between wings; breeding bird darker, more heavily streaked and spotted on head, breast and flanks. Immature browner above with cream edges to feathers. Bare parts: iris brown; bill black with greenish base, straight, fine and pointed; feet and legs various shades of green to yellow. Habitat: tidal mudflats, brackish pools and estuaries; inland waters. Palearctic migrant, some oversummer. <389><391><393>
translation missing: en.license_cc_by_4_0
© WoRMS for SMEBD Source: World Register of Marine Species
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
ECOLOGY
Habitat
Habitat and Ecology
learn more about this article
Habitat and Ecology
Behaviour This species is a full migrant, travelling overland on a broad front between its breeding grounds in central Asia (Russia and Siberia), and its wintering grounds in sub-Saharan Africa, southern Asia, Indonesia and Australia (del Hoyo et al. 1996). The main passage to and from Russia is believed to occur east of the Black Sea (Snow and Perrins 1998), with only a few birds crossing Europe (del Hoyo et al. 1996) (during south-west to south-south-west movements into and out of Russia a small proportion of the species regularly crosses Slovakia, Hungary, the Balkans, Italy and the eastern Mediterranean) (Snow and Perrins 1998). In eastern central Asia the species passes through Mongolia; central, north-eastern and coastal China; Korea (on southward migration only), Japan, Myanmar, Malaysia and Sumatra (del Hoyo et al. 1996). The species leaves its breeding range between the first half of July and early-September (Snow and Perrins 1998), arriving in its wintering grounds in September (del Hoyo et al. 1996). For those birds wintering in West Africa, the Nile valley in Sudan is commonly used as a stop over site before crossing the Sahara (del Hoyo et al. 1996). The species is present in West Africa from September to mid-April (del Hoyo et al. 1996), and departs again between the second half of March and April, passing through central Asia in early-April to early-May, and reoccupying breeding areas again by mid-April to mid-May (Snow and Perrins 1998). Most non-breeders remain in the winter quarters or at intermediate sites during the breeding season (del Hoyo et al. 1996). This species forages singly or in groups of less than 20 (Hockey et al. 2005), although flocks can sometimes exceed 300 (Urban et al. 1986, Hockey et al. 2005). It usually nests solitarily or in loose colonies with pairs spaced less than 10 m apart (Hayman et al. 1986). The species is active both diurnally and nocturnally (independent of moon phases) (Hockey et al. 2005). Habitat Breeding This species inhabits warm inland wetlands from open steppe to boreal forest, including shallow freshwater and brackish marshlands, grassy or marshy lake-edges (Johnsgard 1981), river valleys, flooded meadows (Snow and Perrins 1998) and occasionally salt-lakes (del Hoyo et al. 1996). Non-breeding Outside of the breeding season the species typically occurs on the margins of inland freshwater and brackish wetlands such as rice paddy-fields, swamps, salt-pans, salt-marshes, sewage works and marshy lake-edges, and although it is rare on open coastlines it can occasionally be found on estuaries, lagoons and intertidal mudflats (Urban et al. 1986, del Hoyo et al. 1996, Hockey et al. 2005). Diet This species is carnivorous, its diet consisting of small fish, crustaceans, molluscs, and both aquatic and terrestrial insects (Higgins and Davies 1996, del Hoyo et al. 1996). Breeding site The nest of this species is a shallow depression (Snow and Perrins 1998), often on a mound at the marshy edge of a lagoon, lake or pool (Johnsgard 1981).
Systems
Terrestrial
Freshwater
Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© International Union for Conservation of Nature and Natural Resources Source: IUCN
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
LIFE HISTORY AND BEHAVIOR
Life Expectancy
Lifespan, longevity, and ageing
learn more about this article
Maximum longevity: 7.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)
© Joao Pedro de Magalhaes Source: AnAge
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
MOLECULAR BIOLOGY AND GENETICS
Molecular Biology
Barcode data: Tringa stagnatilis
learn more about this article
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 3 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTATACCTAATCTTCGGTGCATGAGCCGGCATAATTGGAACCGCCCTCAGCCTCCTCATCCGCGCAGAGTTAGGTCAACCGGGAACTTTACTAGGAGACGACCAAATTTACAATGTAATCGTCACCGCCCATGCCTTCGTAATAATTTTCTTCATAGTTATACCGATTATAATTGGTGGCTTTGGAAACTGACTAGTCCCACTCATAATCGGCGCCCCCGACATAGCATTCCCCCGTATAAATAACATAAGCTTTTGACTACTCCCCCCATCGTTCCTATTACTATTAGCATCCTCAACAGTAGAAGCAGGAGCTGGTACAGGATGAACAGTATATCCCCCCCTCGCTGGTAACCTAGCCCATGCCGGTGCCTCAGTAGACCTGGCTATCTTCTCCCTCCATTTAGCAGGTGTCTCTTCTATTCTAGGTGCCATCAACTTCATCACAACTGCTATTAACATAAAACCTCCAGCCCTATCCCAGTACCAAACTCCCCTATTTGTATGATCAGTACTTATTACTGCTGTTCTTCTCCTACTCTCCCTCCCAGTCCTTGCCGCTGGTATCACCATACTACTAACAGACCGAAACTTAAACACCACATTCTTCGATCCAGCCGGGGGAGGGGATCCAGTCCTATATCAACACCTCTTCTGATTCTTCGGTCACCCAGAAGTTTATATCCTCATTCTA
-- end --
Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)
© Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD)
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Statistics of barcoding coverage: Tringa stagnatilis
learn more about this article
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)
© Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD)
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
CONSERVATION
Conservation Status
IUCN Red List Assessment
learn more about this article
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2012
Assessor/s
BirdLife International
Reviewer/s
Butchart, S. & Symes, A.
Contributor/s
Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
History
Least Concern (LC)
Least Concern (LC)
Least Concern (LC)
Lower Risk/least concern (LR/lc)
Lower Risk/least concern (LR/lc)
Lower Risk/least concern (LR/lc)extend the information provided |
