| Citation |
|
Description |
Central America: Atlantic slope, in the Usumacinta River drainage in Mexico, Guatemala and Belize.
Comprehensive Description
Biology
learn more about this article
Inhabits lakes and the lower river valley with a slight tolerance for the brackish environment.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Distribution
learn more about this article
Atlantic Slope: Belize, Guatemala and Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© FishWise Professional Source: FishWise Professional
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Central America: Atlantic slope, in the Usumacinta River drainage in Mexico, Guatemala and Belize.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
PHYSICAL DESCRIPTION
Size
learn more about this article
Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)
© FishWise Professional Source: FishWise Professional
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Max. size
learn more about this article
35.0 cm TL (male/unsexed; (Ref. 36377))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
ECOLOGY
Habitat
learn more about this article
Depth range based on 5 specimens in 1 taxon.
Environmental ranges
Depth range (m): 1 - 3
Graphical representation
Depth range (m): 1 - 3
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved
Source: Ocean Biogeographic Information System
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Environment
learn more about this article
benthopelagic; freshwater; brackish; pH range: 7.0 - 8.0; dH range: 9 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Depth range based on 5 specimens in 1 taxon.
Environmental ranges
Depth range (m): 1 - 3
Graphical representation
Depth range (m): 1 - 3
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain
Source: Ocean Biogeographic Information System
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Trophic Strategy
learn more about this article
Inhabits lakes and the lower river valley with a slight tolerance for the brackish environment. Herbivore (Ref. 78170).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Partner Web Site: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Diseases and Parasites
learn more about this article
Yellow Grub. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Uvulifer Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Stunkardiella Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Spiroxys Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Spinitectus Infestation 5 (Larvae sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Sciadicleithrum Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Sciadicleithrum Infection 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Sciadicleithrum Infection 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Saccocoelioides Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Ribeiroia Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Rhabdochona Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Raillietnema Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Pseudoterranova Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Procamallanus Infection 13. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Posthodiplostomum Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Polymorphus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Phyllodistomum Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Perezitrema Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Pelaezia Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Oligogonotylus Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Neoechinorhynchus Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Mexiconema Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Hysterothylacium Infection (Hysterothylacium sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Homalometron Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Goezia Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Genarchella Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Floridosentis Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Echinochasmus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Drepanocephalus Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Diplostomum Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Cucullanus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Crocodilicola Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Crassicutis Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Contracaecum Disease (larvae). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Cladocystis Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Campechetrema Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Bucephalus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Ascocotyle Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Ascocotyle Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Ascocotyle Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
learn more about this article
Apharyngostrigea Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
LIFE HISTORY AND BEHAVIOR
Life Cycle
learn more about this article
Max. 1000 eggs, sexual maturity is reached at 10 cm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
MOLECULAR BIOLOGY AND GENETICS
Molecular Biology
Barcode data: Vieja synspila
learn more about this article
The following is a representative barcode sequence, the centroid of all available sequences for this species.
No available public DNA sequences.
Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)
© Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD)
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Statistics of barcoding coverage: Vieja synspila
learn more about this article
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)
© Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD)
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Barcode data: Paraneetroplus synspilus
learn more about this article
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 9 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTCTACCTAGTTTTTGGTGCCTGAGCCGGAATAGTAGGAACCGCATTAAGCCTATTGATCCGAGCAGAACTCAGCCAGCCAGGCTCACTCCTTGGAGACGACCAAATCTACAATGTAATCGTAACTGCGCACGCCTTTGTAATAATTTTCTTTATAGTCATGCCTATCATAATTGGAGGTTTCGGTAACTGACTAATCCCACTCATAATTGGTGCCCCAGACATGGCCTTCCCTCGAATAAACAACATGAGCTTCTGACTTCTGCCCCCTTCGTTCCTCCTCCTACTTGCCTCATCAGGAGTTGAGGCTGGTGCTGGGACAGGCTGAACCGTCTACCCCCCACTAGCAGGCAATCTGGCGCACGCGGGCCCCTCAGTTGACCTAACCATTTTTTCCCTCCACTTAGCAGGAGTCTCGTCTATCCTTGGGGCAATTAATTTTATTACCACAATTGTTAACATGAAACCCCCCGCAATCTCCCAATATCAAACCCCCCTATTTGTTTGAGCGCTTCTAATCACCGCTGTCCTACTCCTACTATCCCTGCCAGTCCTTGCCGCCGGCATTACTATACTTTTAACCGATCGAAACCTAAACACAACCTTTTTTGACCCTGCAGGGGGAGGAGACCCCATTCTCTACCAACACCTA
-- end --
Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)
© Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD)
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
Statistics of barcoding coverage: Paraneetroplus synspilus
learn more about this article
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)
© Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD)
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
CONSERVATION
Threats
learn more about this article
Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article
RELEVANCE TO HUMANS AND ECOSYSTEMS
Benefits
Importance
learn more about this article
fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)
© FishBase Source: FishBase
TRUSTED
article rating from 0 people Default rating: 2.5 of 5
comment on or rate this article |