Username :
Password :
           
Taxon ID: 57,420 Total records: 39,143

Vieja synspila

Classification

Kingdom Animalia (COL)
Phylum Chordata (COL)
Class Actinopterygii (COL)
Order Perciformes (COL)
Family Cichlidae (COL)

Taxonomy

Genus Vieja Reference
SubGenus Vernacular Name
Species synspila IUCN Threat Status-Year Not Evaluated, 2000
SubSpecies Nat'l Threat Status-Year Not Evaluated, 2000
Infraspecies Reason for Change
Infraspecies Rank CITES
Taxonomic Group Fish Native Status Not known
Scientific Name Author (Hubbs, 1935) Country Distribution Singapore
Citation Description Central America: Atlantic slope, in the Usumacinta River drainage in Mexico, Guatemala and Belize. Comprehensive Description Biology learn more about this article Inhabits lakes and the lower river valley with a slight tolerance for the brackish environment. Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article Distribution learn more about this article Atlantic Slope: Belize, Guatemala and Mexico. Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0) © FishWise Professional Source: FishWise Professional TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Central America: Atlantic slope, in the Usumacinta River drainage in Mexico, Guatemala and Belize. Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article PHYSICAL DESCRIPTION Size learn more about this article Maximum size: 350 mm TL Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0) © FishWise Professional Source: FishWise Professional TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article Max. size learn more about this article 35.0 cm TL (male/unsexed; (Ref. 36377)) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article ECOLOGY Habitat learn more about this article Depth range based on 5 specimens in 1 taxon. Environmental ranges Depth range (m): 1 - 3 Graphical representation Depth range (m): 1 - 3 Note: this information has not been validated. Check this *note*. Your feedback is most welcome. All rights reserved Source: Ocean Biogeographic Information System TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article Environment learn more about this article benthopelagic; freshwater; brackish; pH range: 7.0 - 8.0; dH range: 9 - 20 Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Depth range based on 5 specimens in 1 taxon. Environmental ranges Depth range (m): 1 - 3 Graphical representation Depth range (m): 1 - 3 Note: this information has not been validated. Check this *note*. Your feedback is most welcome. Public Domain Source: Ocean Biogeographic Information System TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article Trophic Strategy learn more about this article Inhabits lakes and the lower river valley with a slight tolerance for the brackish environment. Herbivore (Ref. 78170). Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Partner Web Site: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article Diseases and Parasites learn more about this article Yellow Grub. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Uvulifer Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Stunkardiella Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Spiroxys Infestation. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Spinitectus Infestation 5 (Larvae sp.). Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Sciadicleithrum Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Sciadicleithrum Infection 4. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Sciadicleithrum Infection 3. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Saccocoelioides Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Ribeiroia Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Rhabdochona Infestation 5. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Raillietnema Infestation. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Pseudoterranova Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Procamallanus Infection 13. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Posthodiplostomum Infestation 2. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Polymorphus Infestation. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Phyllodistomum Infestation 6. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Perezitrema Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Pelaezia Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Oligogonotylus Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Neoechinorhynchus Infestation 6. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Mexiconema Infestation. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Hysterothylacium Infection (Hysterothylacium sp.). Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Homalometron Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Goezia Disease. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Genarchella Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Floridosentis Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Echinochasmus Infestation 2. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Drepanocephalus Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Diplostomum Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Cucullanus Disease. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Crocodilicola Infestation. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Crassicutis Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Contracaecum Disease (larvae). Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Cladocystis Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Campechetrema Infection. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Bucephalus Disease. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Ascocotyle Infestation 3. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Ascocotyle Infestation 2. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Ascocotyle Infestation 1. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article learn more about this article Apharyngostrigea Disease. Parasitic infestations (protozoa, worms, etc.) Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article LIFE HISTORY AND BEHAVIOR Life Cycle learn more about this article Max. 1000 eggs, sexual maturity is reached at 10 cm. Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article MOLECULAR BIOLOGY AND GENETICS Molecular Biology Barcode data: Vieja synspila learn more about this article The following is a representative barcode sequence, the centroid of all available sequences for this species. No available public DNA sequences. Download FASTA File Creative Commons Attribution 3.0 (CC BY 3.0) © Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD) TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article Statistics of barcoding coverage: Vieja synspila learn more about this article Barcode of Life Data Systems (BOLDS) Stats Public Records: 1 Specimens with Barcodes: 1 Species With Barcodes: 1 Creative Commons Attribution 3.0 (CC BY 3.0) © Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD) TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article Barcode data: Paraneetroplus synspilus learn more about this article The following is a representative barcode sequence, the centroid of all available sequences for this species. There are 9 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences. CCTCTACCTAGTTTTTGGTGCCTGAGCCGGAATAGTAGGAACCGCATTAAGCCTATTGATCCGAGCAGAACTCAGCCAGCCAGGCTCACTCCTTGGAGACGACCAAATCTACAATGTAATCGTAACTGCGCACGCCTTTGTAATAATTTTCTTTATAGTCATGCCTATCATAATTGGAGGTTTCGGTAACTGACTAATCCCACTCATAATTGGTGCCCCAGACATGGCCTTCCCTCGAATAAACAACATGAGCTTCTGACTTCTGCCCCCTTCGTTCCTCCTCCTACTTGCCTCATCAGGAGTTGAGGCTGGTGCTGGGACAGGCTGAACCGTCTACCCCCCACTAGCAGGCAATCTGGCGCACGCGGGCCCCTCAGTTGACCTAACCATTTTTTCCCTCCACTTAGCAGGAGTCTCGTCTATCCTTGGGGCAATTAATTTTATTACCACAATTGTTAACATGAAACCCCCCGCAATCTCCCAATATCAAACCCCCCTATTTGTTTGAGCGCTTCTAATCACCGCTGTCCTACTCCTACTATCCCTGCCAGTCCTTGCCGCCGGCATTACTATACTTTTAACCGATCGAAACCTAAACACAACCTTTTTTGACCCTGCAGGGGGAGGAGACCCCATTCTCTACCAACACCTA -- end -- Download FASTA File Creative Commons Attribution 3.0 (CC BY 3.0) © Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD) TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article Statistics of barcoding coverage: Paraneetroplus synspilus learn more about this article Barcode of Life Data Systems (BOLDS) Stats Public Records: 9 Specimens with Barcodes: 20 Species With Barcodes: 1 Creative Commons Attribution 3.0 (CC BY 3.0) © Barcode of Life Data Systems Source: Barcode of Life Data Systems (BOLD) TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article CONSERVATION Threats learn more about this article Not Evaluated Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article RELEVANCE TO HUMANS AND ECOSYSTEMS Benefits Importance learn more about this article fisheries: of no interest; aquarium: commercial Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0) © FishBase Source: FishBase TRUSTED article rating from 0 people Default rating: 2.5 of 5 comment on or rate this article
Source http://www.fishbase.org

Images

         

Additional Info

Synonyms


To Manage Synonyms for Vieja synspila, click this link: Synonyms.
Cichlasoma hicklingi (Fowler, 1956)  ¦   Cichlasoma synspilum Hubbs, 1935  ¦   Cichlaurus hicklingi Fowler, 1956  ¦   Paraneetroplus synspila (Hubbs, 1935)  ¦   Vieja synspila (Hubbs, 1935)  ¦   Vieja synspillum (Hubbs, 1935)  ¦  
Common Names


To Manage Common Names for Vieja synspila, click this link: Common Names.
Localities


To Manage Localities for Vieja synspila, click this link: Localities.
No Locality records in database.
Species Record Updated By: Carlos Aurelio Callangan